{"author_link":"\/author\/gidaio\/","author_name":"Gidaio","author_uid":"14818","comments":[{"author_name":"Gidaio","author_uid":"14818","time":"Aug 28, 2012 @ 1:07am","epoch":1346115720,"text":"Oh yeah. The other members of the team are Bowlercaptain and TNR7. Looking forward to doing this again."},{"author_name":"DevWouter","author_uid":"14393","time":"Aug 28, 2012 @ 6:25pm","epoch":1346178000,"text":"Could have used a clipboard on which we could store the genes. I'm quite certain I didn't type it over correctly."},{"author_name":"Kayelgee","author_uid":"15267","time":"Aug 28, 2012 @ 6:37pm","epoch":1346178720,"text":"I really like the dna maipulate feature\r<br\/>it would help if the discovered combinations would show up at the dna screen and the characters should be right above every base, because it's hard to see which base I am modifying if I have to look to the top like it is now"},{"author_name":"bobiniki","author_uid":"5583","time":"Aug 28, 2012 @ 6:52pm","epoch":1346179620,"text":"I think i got all the codes but I cant defeat the boss :(\r<br\/>I like the idea how you modify your dragon trough the DNA structure. I really want to see this become a finished game(more content better graphics, animations,more customization)\r<br\/>Also what is the difference between the 3 types of attack?\r<br\/>Overall a good game!"},{"author_name":"kevincorrigan","author_uid":"15028","time":"Aug 28, 2012 @ 6:54pm","epoch":1346179740,"text":"Nice concept, I enjoyed trying to find out the dna sequences that did stuff, Good job."},{"author_name":"Gidaio","author_uid":"14818","time":"Aug 28, 2012 @ 7:27pm","epoch":1346181720,"text":"@bobiniki If you're really having trouble, here's a secret: the table floating out in the blackness right before Alex is actually a secret passage where you can modify Alex's Dragon's DNA code and make it suck.\r<br\/>\r<br\/>@Kayelgee That was the original plan. Actually, the original plan was to have the characters show you the DNA sequences in a color format, so it would be easy and intuitive. Unfortunately, as is extremely common, we ran out of time... :\/"},{"author_name":"Oceanspud","author_uid":"16346","time":"Aug 28, 2012 @ 8:01pm","epoch":1346183760,"text":"I fought the big boss Alex.. as soon as it started he jumped off into the sky and died... Anti-climatic :P"},{"author_name":"Gidaio","author_uid":"14818","time":"Aug 28, 2012 @ 11:23pm","epoch":1346195880,"text":"Yeah, it's surprising how difficult it is to program a platforming AI that can adapt to different physics and doesn't use a pathfinding algorithm."},{"author_name":"chuchino","author_uid":"1081","time":"Aug 28, 2012 @ 11:59pm","epoch":1346198040,"text":"Definitely lacks polish, but it's cute and fun. The DNA modification mechanic was cool, even though the interface for it was awkward. I didn't find the secret passage, so I was only able to beat the final boss by standing far away and hitting it with long-range fire breath a ton of times."},{"author_name":"panzermancer","author_uid":"5826","time":"Aug 29, 2012 @ 3:23am","epoch":1346210280,"text":"Yeah, there was no explanation as to how changing a dragon's genes actually worked. It's a shame, because the concept seems really, really cool.\r<br\/>\r<br\/>I just ran through the whole game with the basic dragon. When I fought the final dragon, it immediately jumped so high it went off-screen and died, leaving me the victor. Hilarious as that may have been, I'm sure that wasn't intentional.\r<br\/>\r<br\/>It was a cool idea, though. Good effort, but better luck next time!"},{"author_name":"Kumquat","author_uid":"14739","time":"Aug 29, 2012 @ 5:33pm","epoch":1346261280,"text":"The genetic manipulation is really a great mechanic. I also like the pokemon style, it's a little bit nostalgic.\r<br\/>It will be nicer if it has a tutorial and maybe a book to save the DNA combinations. It was difficult to figure out most of the stuff in the beginning.\r<br\/>There was a bug with the last boss, it just flew away and all of a sudden I won LOL"},{"author_name":"imef","author_uid":"9591","time":"Aug 29, 2012 @ 8:57pm","epoch":1346273520,"text":"I actually really liked that!\r<br\/>\r<br\/>PS : I found a bug! If you move sideways getting out of a room, you end up behind in the dark area! ;)"},{"author_name":"zatyka","author_uid":"14357","time":"Aug 30, 2012 @ 1:31am","epoch":1346289960,"text":"Cool concept, but definitely incomplete.  Please continue with this as I think it has TONS of potential."},{"author_name":"jovoc","author_uid":"34","time":"Aug 30, 2012 @ 6:06am","epoch":1346306460,"text":"Really liked this concept. And this felt like a ton of gameplay given the time limits. nice work."},{"author_name":"nddrylliog","author_uid":"4598","time":"Aug 30, 2012 @ 3:03pm","epoch":1346338680,"text":"Had lots of fun! Like a Pokemon\/Zelda mix, but dragon-themed. Had to admit I never noted down DNA chains to use them later, but instead I just swapped genes randomly to see what my dragon could do.\r<br\/>\r<br\/>Got beaten down twice by THE ULTIMATE DRAGON though. Nice work!"},{"author_name":"demonpants","author_uid":"531","time":"Aug 30, 2012 @ 5:41pm","epoch":1346348160,"text":"Mac version please thanks!"},{"author_name":"Gidaio","author_uid":"14818","time":"Aug 30, 2012 @ 5:57pm","epoch":1346349120,"text":"@demonpants No can do. :\/ Sorry, but none of us own a mac, and currently, the only way to get this game on a Mac would be to buy the hundred-dollar GM Studio."},{"author_name":"whilefun","author_uid":"7424","time":"Aug 31, 2012 @ 1:51am","epoch":1346377560,"text":"Pretty cool. I really liked the DNA strand animation! The best part of this is your description - &quot;BUT IT'S AWESOME THAT WE DID THIS, EVEN IF IT SUCKS.&quot;. That's the key right there. Can't wait to see what your future entries are like! :)"},{"author_name":"CapGrip","author_uid":"15437","time":"Sep 1, 2012 @ 2:02am","epoch":1346464620,"text":"Simple and fun. Change DNA is a great feature, I really like it. Well done!"},{"author_name":"Josh @ Dreamland","author_uid":"5818","time":"Sep 7, 2012 @ 2:41pm","epoch":1347028560,"text":"Full points for Innovation, Theme, and Graphics. Very creative; nice to see a game that actually came up with a creative twist on the theme.\r<br\/>\r<br\/>If anyone wants the best string I came up with, it is this:\r<br\/>agggacttagctaggtttaaatgcgaacctaatcat\r<br\/>\r<br\/>I can't tell if there are any more useful strands or not.\r<br\/>\r<br\/>Also, yeah, kind of annoying entering them manually. Maybe with a keyboard, or clipboard function?\r<br\/>Anyway, nicely done."},{"author_name":"creative630","author_uid":"8156","time":"Sep 12, 2012 @ 1:25pm","epoch":1347456000,"text":"The combat didn't really make me very excited but the DNA manipulation to find interesting enhancements was amazing. Good job."},{"author_name":"tcstyle","author_uid":"4834","time":"Sep 13, 2012 @ 7:27pm","epoch":1347564120,"text":"Nice idea. A little confusing."}],"images":["ld24\/14818-2a9aee57220e674bb7ad3077564a6b75.jpg","ld24\/14818-39eea5e1ea4622a520652a0f02b7ec63.jpg","ld24\/14818-6d454bc8d43c2a052c278b9a885ad194.jpg","ld24\/14818-bcfbb23b0cbf83c7e6e61ab3f3c63ba9.jpg"],"links":[{"url":"http:\/\/dl.dropbox.com\/u\/100108960\/dragoneticist.exe","text":"Windows"}],"metadata":{"g_key":"29192","g_author":"14818","g_event":"LD24","g_eventkey":"12","g_subevent":"JAM","g_urlkey":"29222","g_title":"Dragoneticist","g_status":"UCHK1","g_place":"120","g_commentcount":"22","g_site2_node_id":"0","g_hide":"N","g_has_icon":"Y","g_rqueue":"0","g_random":"0"},"nds":[],"node":null,"orig_images":["http:\/\/ludumdare.com\/compo\/wp-content\/compo2\/\/163678\/14818-shot0.png-eq-900-500.jpg","http:\/\/ludumdare.com\/compo\/wp-content\/compo2\/\/163678\/14818-shot1.png-eq-900-500.jpg","http:\/\/ludumdare.com\/compo\/wp-content\/compo2\/\/163678\/14818-shot2.png-eq-900-500.jpg","http:\/\/ludumdare.com\/compo\/wp-content\/compo2\/\/163678\/14818-shot3.png-eq-900-500.jpg"],"text":"Yeah. This is the first game we've ever done as a team, and it's VERY rough. BUT IT'S AWESOME THAT WE DID THIS, EVEN IF IT SUCKS.\r\n\r\nYeah. Have fun, and remember that there may or may not be more to come.\r\n\r\nArrow keys to move.\r\n\r\nAlso, Windows only, because we don't have GM Studio and we only have PCs. So yeah, sorry.\r\n\r\n-----\r\nStory\r\n-----\r\nYou are a geneticist who is tired of the fact that the real world doesn't have dragons in it. So you set up a lab and start manufacturing the dragons! As you walk in to your lab one day, you notice that all of your work was stolen! Now you must go find out who did it, and beat them into submission with your own custom-made dragon, editing through tampering with the genetic code.<\/p>","title":"Dragoneticist"}